seksuolodzy białystok forum ad

Cztery tygodnie po wystąpieniu objawów nadal występowała gorączka, pacjent stracił 6 kg masy ciała, a rozwój adenopatii szyjkowej nastąpił w dużej podskórnej masie związanej z homo-bocznymi adenopatiami. Liczba białych krwinek spadła do 2900 na milimetr sześcienny, a hematokryt do 23 procent. Wykonano biopsję jednego małego węzła adenatycznego. Tydzień później wykonano drugą biopsję szyjki macicy i biopsję szpiku kostnego. Osiem tygodni po wystąpieniu objawów zaobserwowano spontaniczną regresję masy i gorączki, a jedynym badaniem podczas badania fizykalnego była utrzymująca się łagodna splenomegalia, która ustąpiła w 10. tygodniu. Sześć miesięcy później, w lipcu 1990 r., Duże komórki Rozprzestrzenił się chłoniak Hodgkina zlokalizowany do prawego mięśnia czworogłowego. Całkowitą remisję osiągnięto po sześciu cyklach chemioterapii skojarzonej. W grudniu 1997 r. Rozpoczęto terapię trzykrotnie przeciwretrowirusową, a pacjent pozostał bezobjawowy bez nawrotu chłoniaka nieziarniczego lub rozwoju mięsaka Kaposiego (tab. 1). Metody
Badania hybrydyzacji histopatologicznej, immunohistochemicznej i in situ
Tkanki z węzłów chłonnych i masy szyjnej uzyskano za pomocą biopsji chirurgicznej. Skrawki wybarwiono hematoksyliną i eozyną i barwnikiem Giemsy w celu zbadania patologicznego. Zatopione w parafinie skrawki badano na obecność wewnątrzcytoplazmatycznych immunoglobulin z monoklonalnymi przeciwciałami wobec lekkich łańcuchów kappa i lambda (Zymed, Biosoft, Paris) i przeciwciał poliklonalnych na ciężkie łańcuchy alfa, gamma i mu (Dako, Trappes, Francja). Reakcje immunoperoksydazy przeprowadzono za pomocą komercyjnych zestawów (Dakopatts, Kopenhaga, Dania). Immunofenotypowanie przeprowadzono na zamrożonych skrawkach w celu wykrycia ekspresji powierzchniowych immunoglobulin i antygenów komórek T CD3, CD4 i CD8 (Becton Dickinson, Le Pont de Claix, Francja).
Skrawki zamrożone i zatopione w parafinie zbadano dla utajonego błonowego białka EBV za pomocą przeciwciał monoklonalnych CS1, CS2, CS3 i CS4, które rozpoznają to białko. Skrawki zatopione w skórze zostały również przetestowane pod kątem EBV przez hybrydyzację in situ z sondą swoistą dla transkryptu RNA kodowanego EBV (EBER-1) znakowanego izotiocyjanianem fluoresceiny, zgodnie z zaleceniami producenta (Dako).
Amplifikacja i Southern Blotting
Zamrożone próbki z masy szyjkowej były dostępne do analizy klonalności i detekcji molekularnej sekwencji DNA HHV-8 za pomocą reakcji łańcuchowej polimerazy (PCR). Startery konsensusowe zastosowano do amplifikacji PCR zmiennej (V), różnorodności (D) i łączenia (J) eksonów immunoglobulin i receptorów komórek T. W przypadku genów łańcucha ciężkiego immunoglobulin, przegrupowania V-D-J amplifikowano przez dwa zestawy PCR, a dla genów . receptora komórek T, procedura obejmowała trzy reakcje z trzema mieszaninami starterów, jak opisano wcześniej.15 Produkty PCR były analizowano za pomocą elektroforezy w żelu poliakryloamidowym z barwieniem bromkiem etydyny.
Aby zidentyfikować sekwencje HHV-8, DNA ekstrahowano z próbki z biopsją szyjki macicy zestawem starterów dla KS330233, jak opisali Chang i wsp., i poddano elektroforezie w żelu agarozowym. Produkty PCR przeniesiono następnie na membranę nylonową i hybrydyzowano ze specyficzną wewnętrzną oligoprobatą 5 GGAACTTGATCTATATACACAC3 i znakowano fosforem-32.
Testy serologiczne dla HHV-8
Do badań serologicznych były dostępne próbki surowicy uzyskane 4, 7, 14 miesięcy i 5 tygodni przed wystąpieniem objawów klinicznych oraz 2 tygodnie, 8 miesięcy i 7 lat po wystąpieniu objawów klinicznych.
[podobne: Choroba Perthesa, bikalutamid, diklofenak ]
[hasła pokrewne: zespół aspergera test, zespół aspergera u dorosłych, zespół fallota ]