Stowarzyszenie mutacji w genie Apolipoproteiny B z hipercholesterolemią i ryzykiem choroby niedokrwiennej serca ad

Rozpoznanie opierało się na następujących kryteriach: całkowity poziom cholesterolu w osoczu powyżej 309 mg na decylitr (8,0 mmol na litr) i poziom cholesterolu LDL w osoczu powyżej 232 mg na decylitr (6,0 mmol na litr), ksenotomy ścięgniste u pacjenta lub krewni pierwszego stopnia i wywiad z hipercholesterolemią, chorobą niedokrwienną serca lub obojga krewnymi pierwszego stopnia przed ukończeniem 60 lat. We wszystkich grupach ponad 99 procent było białych, a prawie 99 procent było pochodzenia duńskiego. Wszyscy uczestnicy wyrazili świadomą zgodę. Badania zostały zatwierdzone przez odpowiednie komisje etyczne.
Analizy DNA
Mutacje Arg3500Gln i Arg3531Cys są powodowane przez zastąpienie adeniny dla guaniny w pozycji 10 699 komplementarnego DNA20 i tyminy dla cytozyny w pozycji 10 791 odpowiednio w eksonie 26 genu APOB.7,8 Obecność mutacji określono w puli sample21 w reakcji łańcuchowej polimerazy (PCR): występował wspólny prążek 334 bp i prążek specyficzny dla mutacji 167 bp w przypadku Arg3500Gln i 111 bp w przypadku Arg3531Cys.
W PCR stosowano trzy startery do wykrywania Arg3500Gln (5 GACCACAAGCTTAGCTTGG3 , .mol na litr, 5 GGGTGGCTTTGCTTGTATG3 , 0,025 .mol na litr i 5 TGCAGCTTCACTGAACACT3 , .mol na litr) i Arg3531Cys (5 GACCACAAGCTTAGCTTGG3 0,025 .mol na litr; 5 GGGTGGCTTTGCTTGTATG3 , .mol na litr oraz 5 GAGAAGCCACACTCAAAT3 , .mol na litr); mutacje w starterach specyficznych dla alleli są drukowane kursywą, a niedopasowania w starterach są podkreślone. Temperatury wyżarzania dla dwóch procedur wynosiły, odpowiednio, 48 ° C i 55 ° C, a wszystkie reakcje przeprowadzono w całkowitej objętości 50 .l, ze wskazanymi stężeniami starterów, U polimerazy Taq, 200 .mol każdego trifosforanu deoksynukleozydu na litr, 1,5 mmol chlorku magnezu na litr, x buforu (200 mM chlorowodorek TRIS, pH 8,4 i 500 mM chlorek potasu) i 0,1 do 0,2 jag DNA. Po zidentyfikowaniu mutacji w połączonej próbce DNA każdego z 20 osobników w próbce ponownie poddano PCR, a następnie trawiono MspI 22 lub NsiI, aby potwierdzić diagnozę i określić zygotyczność. Mutacja Arg3500Trp jest spowodowana przez podstawienie tyminy na cytozynę w pozycji 10,69820 w eksonie 26 genu APOB.9 W PCR zastosowano dwa primery (5 GTGTCAGTGGCAAAACACACA3 , .mol na litr i 5 CAGAGGGAATATATGCGTTGG3 , .mol na litr), a temperatura wyżarzania wynosiła 57 ° C. Pozostałe odczynniki i warunki PCR były takie, jak opisano powyżej. Wszyscy pacjenci z rodzinną hipercholesterolemią lub chorobą niedokrwienną serca, a także 2021 osób z ogólnej populacji, którzy mieli poziom cholesterolu i apolipoproteiny B powyżej 70. percentyla dla wieku i płci, byli badani pod kątem mutacji Arg3500Trp. PCR, a następnie trawienie Hsp92II, ujawniły wspólne prążki o wielkości 108 bp i 314 bp oraz prążek specyficzny dla mutacji o 206 parach zasad.
Inne analizy
Testy kolorymetryczne i turbidymetryczne zostały użyte do pomiaru stężenia cholesterolu całkowitego, cholesterolu o dużej gęstości (HDL), trójglicerydów i apolipoprotein B i AI (wszystkie Boehringer Mannheim, Mannheim, Niemcy) i lipoproteiny (a) (DAKO, Glostrup, Dania ); Stężenie cholesterolu LDL obliczono na podstawie równania Friedewalda i wsp. 23
Analiza statystyczna
Wskaźniki rozpowszechnienia trzech mutacji wyrażono jako odsetki z dokładnymi dwumianowymi 95-procentowymi przedziałami ufności.24 Pozostałe dane analizowano za pomocą programu SPSS.25 Aby zbadać wpływ mutacji Arg3500Gln i Arg3531Cys na fenotyp u nosicieli zidentyfikowanych w populacji ogólnej, przeliczaliśmy wartości dla zmiennych ciągłych dla nośników na ich odpowiednie percentyle11 i porównaliśmy je z wartościami dla całej populacji ogólnej, stosując z-score, jak opisano powyżej.21,26 W próbce ogólnej populacji, fenotypy osobników, którzy byli heterozygotyczne pod względem Arg3500Gln lub Arg3531Cys zostały porównane za pomocą testu U Manna-Whitneya z dokładnym dwustronnym prawdopodobieństwem
[więcej w: Enterolklimakterium, ceftriakson, belimumab ]
[podobne: olx węgrów, olx bystrzyca kłodzka, zapalenie okostnej objawy ]